21 September 2009

Montreal / Monday / 1029

thanks! that was a great night, and thanks lindi ortega, and thanks lights.

Montreal / Sunday / 1454

I enjoy being in Montreal - it's pretty odd that you are suddenly somewhere that people speak french, but that adds to the charm. There are loads of people in metallica t-shirts (they are in town too) and there's a fantastic hat shop just around the corner from the venue. I also love the way canadian cities seem to allow graffiti in certain areas (see my blog from the last canadian shows in toronto) - there's an area just like that here, by the venue. tim seems to remember demoing maybe i can change in the dressing room here last time. about to soundcheck for the last time on this tour...

Montreal / Sunday / 1417

Kitchener

are these mufflers fast or very small?

Montreal / Sunday / 1230

blog software not co-operating today, so i hope this works. got tons of pics from Thunder Bay onwards:

D DGE

 

60 donuts consumed in the making of the Thunder Bay show

Debbie and her crew were amazing - they even made us a cake, and we had an aftershow ribs / corn / pizza / mojito party once everything was packed away.

Happy birthday Ant!

call stage manager

driving to Sudbury

dear santa...

Sudbury, obviously.

Tim found this great little bar / restaurant in Sudbury - http://www.laughingbuddhasudbury.com/. it was great, and had a huge selection of beer. and sweet potato fries with banana ketchup (delicious).

Thunder Bay / Thursday / 1753

Winnipeg / Wednesday / 2355

haven't seen much of winnipeg, but i nearly bought a canoe - it was just so cool.

we're now sitting in the back lounge of the bus watching the inbetweeners. again. it's hilarious, and has basically become the centre of our universe.

here are some pics from today...

Click on the pic below to see it at full-screen size:

Moose Jaw / Tuesday / 1852

brilliant sculpture on the campus at Calgary university. genius.

a terrible pun, even before they underlined it.

september 1975

i love the colours of the science building entrance

funky new building...

...where i guess once upon a time there were trees

calgary co-hosted the winter olympics in 1988. brits might remember Eddie "the Eagle" Edwards...

a couple of hares outside the ice-rink. nice camouflage!

photos from Moose Jaw

there are loads of these little things flying around - they look like butterflies when they fly. is it a cricket? or a locust? i have no idea.

i don't know what type of bird that is, but it looked pretty big. i love this scenery.

according to wikipedia, Saskatchewan is derived from a language called Cree, and means swift-flowing river.

these two cars were sat nearby, gradually rotting away i guess, unless they are a project, in which case - good luck!

Chrysler Canada

wooden wheels

i wonder when someone last sat at the wheel - it may be gone, but the gearstick and pedals are still there:

Ant sent me some of his photos from their fishing trip on Maligne Lake, Jasper... for your viewing pleasure - thanks Ant!

Edmonton / Sunday / 1524

i want to live in the rocky mountains. we just had a fantastic day off in Jasper (nice one, colin). tom, ant and adam cdm went fishing. i went for a run, as did kyle, colin and tom. tim rowed beth around a lake, then played tennis with dan (who had also been mountain-biking with scott and a few others). it was the healthiest day-off we've ever had. i went down to the lake to take a few pics in the evening, and ended up having a great chat with a fella sat by the shore - he was a retired canadian economist / banker / navy reservist / professor. we talked about the planets, time, the economy, regulation of business, government and the free market. i learned a lot, including that the brightest light in the night sky last night was venus - he learned how to navigate by the stars when he was in the navy. he told me something that totally blew my mind - apparently, the best navigators, using the stars, could place themselves on a map to within 250 yards of exactly where they were. if you look at the clickable big photo of the stars (there you go, kmpeeps), you can see that in the 30 seconds it took to take the photo, the stars had moved in the sky (they are actually little lines when you zoom in close). so how did those navigators managed to locate themselves so accurately?! amazing. anyway...

on with the show:

library opposite the venue

the pic below is now clickable (so that you can see it bigger...)

spot the shooting star

Vancouver / Friday / 1918

ok, i've just had dinner (fried tofu and veg, then an amazing chocolate mousse). here's the last batch...

flying in to Seattle

replica of the voyager airplane that flew all the way around the earth, piloted by Dick Rutan and Jeana Yaeger in 1986, Seattle airport

Tahoma or Mount Rainier, in the distance, as we left Seattle for Portland.

we stopped to get some supplies for the bus, and a few beers to celebrate my (32 hour-long) birthday!

Portland (probably my favourite town in the USA) shop window.... um... what?

TOFU wins!

Jesse and i met up with the lovely Brandon from the Helio Sequence (you must listen to their album keep your eyes ahead - it's brilliant). we went here for the finest cup of coffee in North America. fact.

Seattle

woke up early and went for breakfast down at the market. top hash browns! it's a lovely view, and we had a beautiful summer's day. met up with Jason from the fabulous Death Cab for Cutie and went to Don Bennett's drum store - half museum half shop, and a really nice, friendly, welcoming bunch of people.

one of the most depressing signs i've read in a long time. it's pretty clear that the state of the economy is hitting hard over here too. there are more closed-up stores and homeless folks than last time we were here. i really hope President Obama gets the support he needs to pass his plans for healthcare, and the many other reforms that the people here need. i also hope that some of the jobs that have gone return soon. This was the Outdoor Store, Seattle. How gracious, that in the toughest of times, probably the most depressing day, the owners thought to put up a sign saying thankyou - that's pure class, and that's what i love about the USA.

"ORD"

The stars of the show! Shawn Smith was fantastic - he has the most amazing voice, and was a pleasure to have with us. Jesse recommends the following: The Family or EDC by Satchel; Shame or Interiors by Brad; or any of his solo records.

turns out there's a disused swimming pool under the venue in Seattle - naturally, i wanted to have a look...

i turned the corner to see this life-sized father christmas staring at me. it was like a horror movie, and i was about to get axed to pieces.

dan and me (as a ghost!)

Vancouver / Friday / 1746

More from Russia:

we were in special carriage, number zero...

i didn't want to invade people's privacy, so i took this photo through a window in a way that you can't see anyone... but i wanted to try to show what the carriages full of bunks were like. they were absolutely packed. the beds on the left of this photo went lengthways, and the ones on the right were sideways on, to fit more people in. walking back from the bar was like an obstacle course (not because of the drinks...) - you had to duck underneath the odd overhanging foot or leg. it was one of the most enjoyable keane touring experiences so far, though we did have the luxury of cabins. some of the fans on board gave us gifts, including the most amazing book of photos from all around the country, and a fantastic russian doll, custom painted with keane figures and artwork - i was amazed.

Andy took us to this bar / restaurant in Moscow.

another bridge / padlock / love project? this was in St Petersburg

Vancouver / Friday / 1510

long time no blog! got a load of photos from the last couple of weeks, including a few from The Russian Federation, as Colin insisted on calling it. We've been busy, that's for sure. The Russian shows were really fun - the crowds really went for it - a couple of thousand at each show, making the noise of a much bigger crowd!

the US / Canada tour is off to good start, though for a while tom was losing his voice. got soundcheck at 3.30 so i'm gonna post a few pics, then come back and do a few more later.

V festival, stafford

WW2 memorial, St Petersburg

i always find it slightly unnerving when our drivers have little things that look like they are meant to keep us safe... this one was particularly disturbing

Peter The Great

i went for a wander around St Petersburg - it is a really amazingly beautiful city. this was at the fort, across the water from where i was staying. just after i took this picture it struck midday, and someone let off the most ridiculously loud cannon about 100 yards from where i was standing. i had no idea it was gonna happen, and i pretty much jumped out of my skin.

Colin, TMTTS, probably enjoying another of Tom's impressions of him.

chocolates!

the birthday boy

this is where we ended up... the restaurant car on the train to Moscow.

more in a bit...

Comments

hello KEANe me encantaron las fotos very good los amo saludines vengan a mexico!!!!!!!!!!

Posted by liliana on 2009-10-17 17:56:42

*TACO TIME* lol!! ...hope you are well guys, we miss you a lot!!

Posted by yessicachaplin23 on 2009-10-06 02:23:44

hello vengan a perú please los queremos mucho

Posted by lovely tomy on 2009-09-30 04:52:37

Hi Lord : excuse me but better late than never for a reply... So, thanks for the link about the graf art and by the way, thanks to Emmybear but most of all for her help about the transcription of the Q&A at V Fest... Great job ! Much appreciated, thanks ;)

Posted by Agnes(Fr-15/07/2007) on 2009-09-29 22:42:58

@ timtamtom, that is very true about the distance, my dear! lol. i was just thinking south africa because i remember reading that tom did a year abroad there. ;) @ agnes, that is so cool that you saw miss hope's tag in the pics! these graf artists are all over the world. fyi, emmybear posted this link in the forum http://bombit-themovie.com/blog/ on graf art around the world. always and forever, lord byron the girl

Posted by lord_byron on 2009-09-28 08:06:16

YOU ARE THE BEST GUYS,THANKS RICH I LOVE YOU LOVE KISSES AND MANY MANY LOVE FROM MEXICO!!!!!!!!!!!!!

Posted by CLARA LUZ on 2009-09-27 03:57:05

Wow! beautiful,beautiful pics! ...I specially love the stars in the sky pics,and venus! ... we can see it here,it's amazing! there's another world out of our planet! ^^ ..... nice to see your having fun guys,have a nice weekend .....xxxxx =)

Posted by mayra yanett chaplin on 2009-09-27 00:15:56

Ual, great photos !!!!!!!! ... The sky and the stars, so magic !!! Thanks a lot Richard ! I love you, Tom !!!!!!! Raissa. Brazil - São Paulo.

Posted by Raissa on 2009-09-26 19:59:59

@Lord Byron: Sure it would be something great to have the guys here in Africa, but, South Africa-as you said- would be just too far for me : it's the opposite point of the continent! Actually, I promised myself that next time they'll be on stage in France, I'll go there ! France is closer to me than South Africa!

Posted by TimTamTom on 2009-09-26 17:06:57

I love your pictures!!!!! they are just great!!!!!! :D Haa!! and by the way, the little thing that looks like a butterfly is a grasshopper :P haha!! kisses and hugs from MexICo!!!!!

Posted by ana1308 on 2009-09-24 05:11:22

muy buena estructura, muy buen arte, muy buenas tomas... algo mas??? Saludos!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!! Isa!

Posted by isaura-dias on 2009-09-23 18:41:09

Hey, the joker or maybe I should say Mr spits fire !... So, this is the last pic and is that true you're on the road to free Troy ?!... We can't wait to read more about this adventure !... It's a real thrill to learn you're going in the death row in order to accompany and support some smart people, so proficient and deeply involved, and above all that you're about to meet Troy (& his family) in person very soon, and plus to give few conferences and so on... I guess that most of us would like to be a butterfly on your shoulder !!!... And from the moment I saw you with this T-shirt, I knew you would never give up the case anyway or a bit like a headstrong dog with a bone, Hihi !... By the way, it was really great to receive a message in last august from AI that was saying in summary : Object/Supreme Court says Troy deserves another chance/ "(...) It's working. But we won't stop pushing until Troy DAVIS is granted clemency (...) Keep hoping for more miracles, because given today news, it's clear - anything is possible ! We can't say it enough - thank you, Laura MOYE."... And now ;) I'm confident that you're going to give some great reports about this beautiful and good deed and to come back with a victory... COOL !!!...

Posted by Agnes(Fr-15/07/2007) on 2009-09-23 10:41:08

Richard, thanks again for the brilliant pictures. You certainly have a great eye for the beautiful, remarkable, unique, wondrous and sometimes the bizarre--thank you for allowing us to see what you see. Hoping that Santa (not the murderous Father Christmas, of course) delivers you that sensational tractor...lots of great land in Utah for tractor riding :)

Posted by heatherfeather on 2009-09-22 23:58:35

______GGGGGGGGGUUUUUUUUAAAAUUUUUUUUUU !!!!!!!!!!!!!!!!!_______ ,.................. EXCELENTES FOTOS !!!!!!!!!!!!!!!!! ♥♥♥♥♥♥♥ ARGENTINA♥♥♥♥♥♥♥ LOS ESPERA SIEMPRE !!!!!!!!!!!!!!!!!!!!!♥♥♥♥♥♥♥ -----UNCLE RICH SOS UN GRANDE !!!!!!!!!!!!!!!

Posted by luli_argentina on 2009-09-22 17:19:27

Grazie Richard per la foto del vostro concerto: sono contenta che sia andato bene ! Ieri ho ascoltato la vostra nuova canzone , " Sovereign Light Cafe ", rispecchia il vostro inconfondibile stile , sempre molto orecchiabile e gradevole, mai rumoroso nè fastidioso !!! Per me è stato amore al primo ascolto, grazie per le emozioni in musica che mi regalate ! Un bacione dalla vostra affezionata fan Sabrina da Catania!

Posted by Sabrina v. on 2009-09-22 09:38:30

Congratulations for persuating your all gig !! And thaks a lot for coming to JAPAN twice a year ! Your gigs were very very wonderful, and I miss you very very much. I like 1st, 2nd and 3rd alubum all, but some people want you not to change, I think. Although I cheer for you always, and I cheer for your callenge, please don't forget a sence of yourself, I hope. I like your new song, Sovereign Light Cafe ! It is a song just KEANE yourself. Please come back again to JAPAN so soon. I love Tom, Tim, Rich and Jesse !! FROM JAPAN

Posted by YUKO on 2009-09-22 07:55:50

que fotos tan raras. Me ENCANTARON. i LOVE the pictures Richard!!!!!!!!!!!!!!!! Keep 'em coming. I love you Richard.

Posted by babytom on 2009-09-22 03:48:44

me too, Guitargirl496. montreal's so awesome. graf art is all over in alot of cities in europe too. btw, i just noticed the tag in the "underpressure" photo as up 2009! i think this might be the ill crew that does this stuff: http://www.underpressure.ca/?tag=graffiti always, lbtg

Posted by lord_byron on 2009-09-22 03:35:28

Montreal is such a beautiful city, and it's awesome that everyone speaks French and English. I wish we could do that here in the U.S. That is some interesting graffiti, by the way.

Posted by Guitargirl496 on 2009-09-22 02:29:38

to everyone involved with Keane,thank you for giving us a most fabulous tour. the songs are nothing without the band and the band are nothing without the band.....or something like that!! lol anyways,have a fab break,christmas and come back with a sack load of tunes for us to dance and sing our socks of too. COME DO WALK THE WIGHT WITH ME MR HUGHES!!! :-) YA KNOW YA WANT TO......

Posted by cjswench on 2009-09-22 02:24:27

Thanks for all the pictures!!! You really made me feel like i was there!!! Love all the graffiti!!!! Love so much New England

Posted by music_loves_life on 2009-09-22 01:39:15

thanks!

Posted by maria(mexico) on 2009-09-22 01:20:28

I liked your photos rich!

Posted by maria(mexico) on 2009-09-22 01:18:33

Happy Birthday Ant ! Congratulations to you and your partners for your brilliant work. Another successful tour ! Thanks for your devotion and suport to our idols. Finally you can rest and relax. Have a great holiday ! PS.: The new song is really incredible !!!!!!!!!!!!!!

Posted by roosy on 2009-09-21 23:29:45

dearest keane, thank you so much for the wonderful concert in montreal. you totally have a new fan in me and others i have met on and off the board. also, happy belated birthday to ant. as for the new pics, i am loving the graffiti too esp that one of 'under pressure.' i immediatly thought of keane's cover of queen and the encore! it must have been a kick knowing that you all were playing in town and seeing this. @ timtamtom (keane in north and/or south africa would be awesome, btw!) and johanna, i keep feeling this 'melancholy' thing as well as the tour ends. that's a great word to describe what we might be going through as yesterday was the last official gig of the ps tour. it's like a massive, sad sigh of nostalgia that escapes us when we know keane are all well but done for now. true, the boys and crew need a well-deservered rest and recovery but please forgive us for our never-ending want and desire for more. always and forever in music, lord byron the girl

Posted by lord_byron on 2009-09-21 23:11:09

Guys, i love you, but pleeeeaaassse, next time you come to Montreal, don't show a canadian Flag! Awesome show by the way, haha :)

Posted by emieway on 2009-09-21 19:42:49

Un petit coucou de Paris vite fait en passant. What a photoblog ! Merci Richard ! The cats ' wall is funny. And the landscapes are wouaw !!!...The Maligne lake....the picture of the lake with the stars ....(et pas mal the one with Tom and the bear). Do you know that you are very very lucky to see such beautiful views, visiting all these countries? (yes of course you know ;) ) What a strange life ! Celibrity, all the time on the road, but discovering a lot of things everyday. Bien le bonjour aux 4 de Keane.

Posted by athallie on 2009-09-21 19:27:58

The Kitchener show was absolutely incredible....and might I say...a few friends who went to see U2 this week, said your show was MUCH better!!! I needn't any convincing of course! Now that you see how much you're loved here in our quiet little town...fingers crossed you'll come back again. Thank you guys for coming out to see me and my boys (humouring the old broad with the kids :P), you completely made my day. And thank you Tom for letting yourself be dragged away from your nap to come out to see me too. My boys were really sorry they didn't get to meet you too. P.S. The new song is brilliant!!!!!!!

Posted by kbug7373 on 2009-09-21 19:24:50

Many thanks for a lot of your time and effort dedicated to us.These marvellous pics and videos will remind me for ever of you and of fleeting sentiment when I look at them. The new song is very nice , / lyric as well/ despite of it isn´t your usual style of music / "nothing endure but change"- Heraclitos/ wish you all the best, a lot of love , / I love very much also reeds or a reed, I don´t know why.../ have very beautiful holidays

Posted by Denislavia on 2009-09-21 17:45:12

Foufounes électriques! Mouahahaah Richard you made my day =DD I hope you know what does Foufounes électriques mean XD

Posted by Car0le-20 on 2009-09-21 17:29:44

Richard, thank you so much for the photoblog, it's been great seeing all the places you've been to. You are very kind. xx

Posted by sam (uk) on 2009-09-21 16:39:43

is this the final pic? well, I wish you a good rest, you need it all. Looks like this! Thanks, for the blog, Richard! The pic with the rainbow-centre sign I like the mood in it, if there´s a mood, hahhhahhaaa. Thanks, for all the good gigs & blogs, maybe till next time!

Posted by Johanna on 2009-09-21 16:23:05

Hi guys. Wow, you’ve finished your tour! Normally, I’m not one to comment on whatever is posted on the site – although it’s fun and nice to get a glimpse of the weird and wonderful life behind the scenes – but I just wanted to thank you (and the team) for three great concerts/shows this year. You had me at the first album, but absolutely won me over when I saw you perform live in Rotterdam last year. I was completely blown away. I find that few bands are very good live. Tom, I’m amazed how well you sing live, incredible, and so much energy! And Tim and Richard, even as you basically sit down, and Jesse the energy you have on stage and give the crowd is terrific. I’ve listened to your music a lot lately and each time I discover some new sounds. It’s great to hear the music evolving as well. On each album the volume seems to increase; sounds building up. Tom’s voice seems to have more vigour and intensity behind it. Leaves me wondering what the next album will sound like (can’t wait!). Recharge your batteries and enjoy your well-deserved time off.

Posted by flossie on 2009-09-21 16:05:53

MR HUGHES!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!! Thanks for updating! ....Last time???....We're gonna miss you guys....It was an incredibly tour!!!...THANK YOU KEANE!.....HugsAndKissesToKeane

Posted by samanta.g on 2009-09-21 15:59:55

Helloo!!! It's a shame that the tour is over!! it's was so fantastic for me, and i can't wait to get the chance of see you again! About your new geat beatiful song, i found the lyrics and a really good video, now i do understand what you sing jajaja enjoy!!! http://isafanhp.blogspot.com/2009/09/sovereign-light-cafe_20.html

Posted by Little Diana on 2009-09-21 15:49:20

Hiya Richy thanx again 4 the pix/blog thanx 2 u all 4 Sovereign Light cafe its an amazing song i hope its on the mini album next May and My Shadow both great tracks u sang My Shadow at Island 50 i was there that nite u sang it 1st time in the U.K. hav a safe journey back 2 the U.K glad all your world tour was fantastic u now deserve a decent break u will all b so shattered luv u all miss u all bye 4 now Tim, Richy, Tom, Jesse XXXX, Adam X, all at team Keane X and a hug and X 4 Colin luv ya Colin.

Posted by Babs2009 on 2009-09-21 15:33:17

So many amazing photos. I really enjoy seeing them. The little insect you had asked about is a type of grasshopper.

Posted by Michelle316 on 2009-09-21 14:35:48

...................................................................... ...................................................................... ...................................................................... ...................................................................... ...................................................................... ...................................................................... ............................................. Let's dedicate a song or two for our guys; mine is "I get a kick out of you" of Ella FITZGERALD, simply because it's a real thrill listening to their songs- or may be "When you're gone" of The Cranberries because I'm already missing Keane's sound..... ;o( Kenza-ALGIERS-ALGERIA. ...................................................................... ...................................................................... ...................................................................... ...................................................................... ...................................................................... ...................................................................... .............................................

Posted by TimTamTom on 2009-09-21 13:47:47

PERFECT PICS RICH ¡ ¡ ¡ ¡ WE HOPE HERE IN COLOMBIA THAT YOU GUYS REMEMBER ALL THE PLACES WHERE YOU WERE...IN THIS TOUR,AND COME BACK AGAIN, ONE TIME IS NOT ENOUGH, WE HAVE A LOTE OF LOVE TO SHOW YOU KEANE, I LOVE YOU SO MUCH AND I'VE BE WAITING FOR MORE NEWS ABOUT YOU,KISSES,BYE :) =)

Posted by alejasol on 2009-09-21 12:54:30

My dear Tom: Have a super wonderful week!!! Keep doing your things! I wish you all the best… success, prosperity, health,…and so on; in your life.... " Hope is like a bird that senses the dawn and carefully starts to sing while it is still dark" Love you! Rachel xo

Posted by RACHEL-RIO-BRAZIL on 2009-09-21 11:10:17

A quick hello to say thank you for this beautiful work to share your moments with us and make us part of your life. May your week be filled with miracles of hope and inspiration.Blessing and Light, and a deserved rest for every one.Love always,Rachel

Posted by RACHEL-RIO-BRAZIL on 2009-09-21 10:44:48

Ciao Richard, che bella sorpresa oggi !!! Con queste immagini mi hai fatto sognare ! Sono contenta di trovarvi così in forma , state tutti benissimo e noto che siete anche più rilassati , questo mi fà tanto piacere , è bello vedervi tranquilli a bere qualcosa in un bar, godersi le cose semplici della vita è la cosa migliore che si possa fare ! Mi sono piaciute tantissimo anche le foto dei palazzi e dei murales, davvero molto colorati ed originali e molto stravagante il negozietto di cappelli ! A proposito di cose insolite ed estrose, sapete, l' altra sera mentre ero in macchina con i miei, ho rivisto quello strano personaggio che abita nel mio popoloso e colorito quartiere : si tratta di una specie di giovane saltimbanco, che offre spettacolini di prestigio nelle piazze; porta sempre con sè una valigetta piena dei suoi "attrezzi" da lavoro . Usa dei costumi da circo per imitare Charlot, Superman, Houdini , Nuvolari, eccetera...Il buffo è che esce da casa direttamente combinato così e quindi lo si può incontrare con i suoi cappelli a cilindro, i mantelli svolazzanti, i baffi e gli occhiali finti , i capelli carichi di gel acconciati secondo il personaggio al bar, alla fermata dell' autobus o in rosticceria mentre mangia panini e patatine fritte. Ma lui è assolutamente noncurante degli sguardi incuriositi dei passanti, anzi con fare spiritoso e la testa un pò inclinata , ci guarda propriamente tutti quanti come se gli strani siamo noi... Mi sono divertita a raccontarvelo perchè l'immagine di quell' uomo con il cappello mi ha ricordato lui ! Un bacione a te Rich e anche a Tom, Tim e Jesse, a presto da Sabrina from Catania , Sicily!

Posted by Sabrina v. on 2009-09-21 10:15:58

Yo !... Kudos & thanks Richard, I'm so glad you took this pic of Miss Hope graffiti who apparently is part of a talented group of young artists from Toulouse (Hourrah !) the Sistas GrafficX (SGX) because now, I'll be able to recognize one of their amazing "Bombing arts", maybe somewhere in my region... So amazing to think you can find some of these works all over the map but also suddenly au hasard d'une rue in Montpellier or Sète, for instance !!!... ♥KEANE♥, according to the usual formula : Have a nice trip back home ! Take a good rest but please, don't change a winning team and try to keep us informed as soon as possible... Oh and true ! WE ARE SO SAD en espérant que vous languirez de nous aussi : un peu...beaucoup...passionnément...à la folie !... Parce que pas du tout, ben ça nous e**erderait franchement ;D

Posted by Agnes(Fr-15/07/2007) on 2009-09-21 10:13:27

By the end of this tour, I’m feeling in a melancholy mood : I’m gonna miss one of my favourite bands songs – God thanks they gave us “Sovereign Light Café” recently! I’m eager to hear from them again, especially about the mini-album to come! ~*~*~*~*~*~*~*~*~*~*~*~*~*~*~*~*~*~*~*~*~*~*~*~*~*~*~*~*~*~*~*~*~*~*~* ~*~*~*~*~*~*~*~*~*~*~*~*~*~*~*~*~*~*~*~*~*~*~*~*~*~*~*~*~*~*~*~*~*~*~* ~*~*~*~*~*~*~*~*~*~*~*~*~*~*~*~*~*~*~*~*~*~ Since 2004, I’ve always thought that their music was something special, despite the fact that they come with a new sound for each album. Some of the lyrics mean so much to my heart and mind, and it’s something I rarely felt with a song written in something else but French. ~*~*~*~*~*~*~*~*~*~*~*~*~*~*~*~*~*~*~*~*~*~*~*~*~*~*~*~*~*~*~*~*~*~*~* ~*~*~*~*~*~*~*~*~*~*~*~*~*~*~*~*~*~*~*~*~*~*~*~*~*~*~*~*~*~*~*~*~*~*~* ~*~*~*~*~*~*~*~*~*~*~*~*~*~*~*~*~*~*~*~*~*~ Some days, Keane’s songs had a relieving power on my sorrow. In fact, I’ve been through a bad story and I found it very helpful listening to something like “Leaving so soon” or “Again & Again”. Even if it’s kind of insane, I’m really feeling grateful toward those guys! Maybe I should send them a kissagram ;o) ~*~*~*~*~*~*~*~*~*~*~*~*~*~*~*~*~*~*~*~*~*~*~*~*~*~*~*~*~*~*~*~*~*~*~* ~*~*~*~*~*~*~*~*~*~*~*~*~*~*~*~*~*~*~*~*~*~*~*~*~*~*~*~*~*~*~*~*~*~*~* ~*~*~*~*~*~*~*~*~*~*~*~*~*~*~*~*~*~*~*~*~*~ Lots of love guys, Take care and come back very soon: we already miss you! Kenza-ALGIERS-ALGERIA.

Posted by TimTamTom on 2009-09-21 10:07:46

Good morning to all! ohhh today it's a sadly day because it's the last blog. thanks a lot mr special pilot guide. It's incredible to travel with you at this lovely way. i love all of your pics. you deserve a big rest. and happy birthday too mr sexy man Ant. how old? you apparently 17 or 18. have a nices holidays. and the last thing. you are soy cruel boys, because till october i will start to drink a lot of beer, i will finish like homer simpson. kisses from a very blurred and why not a happy day in spain!!!!!!!

Posted by amada on 2009-09-21 09:47:45

Thank you so much Richard brilliant as usual i only have one question .....WHAT ARE WE GOING TO DO NOW ?...never mind we know you all need a good rest thanx to you and the team for all the posts take care xxx from staffordshire xxx

Posted by ruthie on 2009-09-21 07:48:29

thanks for your pics Rich!!!!we are gonna miss you so so much!! !:-( but please don´t stop updating... I don´t believe you stop working for so long so if you, after your holidays, start working in songs or sth let us know!! doesn´t matter if you´re not touring...you have to promise that!!!!don´t forget us and please COME BACK TO ARGENTINA SOON!!!!we love you!!!you´re shining stars in our beutiful sky!!TTRJ------------->kisses and hugs, enjoy your holidays!!!!you did great in this tour you deserve some rest ;-)Happy holidays

Posted by vicichuela on 2009-09-21 07:40:56

Great Photots! Glad your enjoying your tirp. Canada is going to be very sad when Keane leaves, but is very excited for the next visit!

Posted by gtse on 2009-09-21 07:12:04

Thanks again Richard for your photoblogs. I hope the gig at Montreal was great. Every one look in great form in the pictures, but I wish every one a deserved rest.

Posted by Mihajasoa on 2009-09-21 06:22:34

heey jesse is that photo? woow jaja me drool too much when I saw these donuts or that cake, wow what a beautiful it is not montreal? ... well KEANE come back to Argentina please! UP KEANE!

Posted by keane_8@hotmail.com on 2009-09-21 03:30:30

Ohh Rich, amazing pics!! Oh it hurts a little to see you saying "about to soundcheck for the last time on this tour", this tour was totally perfect and unforgettable, me and my dear friends had the best time of our lives... I'm gonna miss it so much! Thank you and Keane for your music, your amazing blogs and your LOVE!! I truly love you guys, God bless you!

Posted by Cris Try Again on 2009-09-21 03:01:32

"Foufounes Eléctriques", what a grafitti! what a meaning ! ha ha ha - I like the one with the eagle and the little boy, black and white grafittis are fabulous! - Kenza-ALGIERS-ALGERIA.

Posted by TimTamTom on 2009-09-21 02:12:29

Oh! talk about sinchronicity!! just came back from the Laughing Buddha here in Sudbury now, and decided to come to the blog and see the photos!! if for a moment in space and time ... it was just a small step behind... I really love those sweet potatoes with banana ketchup, and the lemonade is great too! since I will be staying between here and Toronto for the next year, maybe another time and space effect will bring another tour over.... what I love most about the universe is its creativity: who knows?!

Posted by anabela on 2009-09-21 01:30:01

thank you SO much for all your fabulous photos and comments. :-) on another note,wanna do WALK THE WIGHT with me next year? :-)

Posted by cjswench on 2009-09-21 01:20:48

amazing pictures, thank you Richard!^^ ...but i'm really sad 'cause this tour is over aww :(... anyway, I hope you enjoyed the last gigs guys :D... See you soon! LotsOfLove.

Posted by yessicachaplin23 on 2009-09-21 01:07:07

@Agnes(Fr-15/07/2007) ok, ;) u´re welcome...niza x

Posted by niza on 2009-09-21 00:54:11

Wow, waiting 3 days to this new pictures totally worth it! thanks Rich for the amazing pics of you guys, i think is the first time in a long time, that we can see a Keane relax side, not all interviews and stuff. i hope you have an amazing night at the last gig! sadly this is ending but you deserve to be lazy for a while, Cool have your music in my life in october it will be 5 years since I'm a Keane fan, i don´t care about the jobs i lost to travel to see u, i was happier than ever in your concerts, you gave me joy and happy moments and happy memories. Love you guys!!! i´ll wait the end of this with a smile on my face and anxious to see what´s next ! Love Love Love niza from magallanes.----------> PS: who was the amazing photographer who took your and jess´s pic with half of you hands: :P and God Rich that "LAST SOUNDCHECK "broke my heart! -------->PPS: i love SLC."

Posted by niza on 2009-09-21 00:50:10

I whole-heartedly agree with ibomb. I'm totally ashamed at the size of the crowd (I blame TB media...I did not hear one single Keane song played on the radio and the only advertisement was "the band without guitars".) But I believe that the fans you do have here are ardent and screamed their hearts out that night and feel completely honoured that you chose to debut Sovereign Light Cafe here in our humble presence. I love the song...it's awesome. I must admit that your photo of the rundown stripper bar is ironically indicative of our current situation. This town is dying and if any more industries close we don't stand a chance. We love you and maybe we can catch you in Minneapolis on your next US tour.

Posted by jennyanddave on 2009-09-21 00:22:04

Hi Richard, you're finally giving aftershock to our complaints... A bit forced ?! Oh, Sorry to be nutcrakers !!!... About the French speaking that adds to the charm... Well, thanks !... You are such a gentleman, before to be the worse scoundrel five seconds later !... I wonder if you have glimpsed these elks :P Too funny to find ARRET road signs over there whereas we have STOP road signs in France... There are too many pictures by now and it's a real hassle to comment, Hihi !... En tous cas , c'est vrai qu'ils peuvent nous remercier plutôt deux fois qu'une avec tout ce qu'ils nous pompent comme fric...à la pompe !!!... By the way, you look so pale for a guy who comes back from the rocky mountains but maybe you've spent too much time to hang out at the Foufounes Electriques, these last days !... That name is hilarious actually, and you're really fond of graffiti !... By dint of wandering, I don't know what you're gonna unearth one day but I think if you really need a tractor then it's simply as you need to plough... I know that's lame but there's no difference between me and a rattle : we're doing the same noise when shaking head !!!... @Niza : it's very kind ! Thanks for this offer but I think I'm gonna wait the release with a better sound.. And then there's no hurry indeed !

Posted by Agnes(Fr-15/07/2007) on 2009-09-21 00:15:40

Ps.... thanks for Mr. R-O 's pics... bye

Posted by nina on 2009-09-21 00:13:49

Mr. Hughes....thank you for the on going blogs....much appreciated...caught sight of a new song on your Thunder Bay set list....SLC (saw it, read it and heard it).......simply uplifting.....it'll make my post surgery recovery time pass by a little smoother....thanks for the treat....from my heart to yours...have a safe journey home...... been wandering too long in the dark, at first not by choice but by the final journey every man must make and every surviving soul must endure......though darkness holds its own beauty....it's time I step into the light....... hope to hear from you soon... hope you post pictures ...not of faraway lands ....but of the place you call home.. your London Town take care...

Posted by nina on 2009-09-21 00:12:32

~*~*~*~*~*~*~*~*~*~*~*~*~*~*~*~*~*~*~*~*~*~*~*~*~*~*~*~*~*~*~*~*~*~*~* ~*~*~*~*~*~*~*~*~*~*~*~*~*~*~*~*~*~*~*~*~*~*~*~*~*~*~*~*~*~*~*~*~*~*~* ~*~*~*~*~*~*~*~*~*~*~*~*~*~*~*~*~*~*~*~*~*~*~*~*~*~*~*~*~*~*~*~*~*~*~* ~*~*~*~*~*~*~*~*~*~*~*~*~*~*~*~*~*~*~*~*~*~*~*~*~*~*~*~*~*~*~*~*~*~*~* ~*~*~*~*~*~*~*~*~*~* 60 Donuts? The guys are turning Simpsons or something like that? lol Honestly, I'm gonna miss Richard's blog: it enables me to travel a bit when being in front of my screen. But how could this be the end of Keane's tour: they haven't been in North Africa yet? lol However, they've been on the go for several months and it's time for them to have a rest! Actually, I think that there's no reason to be sad for the end of the tour because we all no that LOVE IS THE END ;o) Wishing to see them on stage soon (for the first time ever....) Kenza-ALGIERS-ALGERIA. ~*~*~*~*~*~*~*~*~*~*~*~*~*~*~*~*~*~*~*~*~*~*~*~*~*~*~*~*~*~*~*~*~*~*~* ~*~*~*~*~*~*~*~*~*~*~*~*~*~*~*~*~*~*~*~*~*~*~*~*~*~*~*~*~*~*~*~*~*~*~* ~*~*~*~*~*~*~*~*~*~*~*~*~*~*~*~*~*~*~*~*~*~*~*~*~*~*~*~*~*~*~*~*~*~*~* ~*~*~*~*~*~*~*~*~*~*~*~*~*~*~*~*~*~*~*~*~*~*~*~*~*~*~*~*~*~*~*~*~*~*~* ~*~*~*~*~*

Posted by deleted on 2009-09-21 00:12:29

Richard: more great photos!! Kitchener was amazing last night so glad I got to hear Sovereign Light Cafe live!! Thank you so much to Tom Tim and Richard for meeting everyone, getting pics, and signing my tour book!! Amazing concert! LOVE YOU KEANE

Posted by Fly-To-Me-Keane on 2009-09-20 23:58:22

It's really too bad you didn't get out more in Thunder Bay. So many beautiful places besides Taco Time and A and W and a some what scary residential area! It hurts my heart because the crowd sucked and I'm sure you guys will never come back here. But, hot dog did you miss some AMAZING photo ops. It's too freakin' bad :(

Posted by lbomb8 on 2009-09-20 23:32:51

Ual, amazing album KEANE, really beautiful photos (thanks Richard !!). Have a great time guys, aways !!!!!! I love you, Tom !!!!!!!! Raissa. Brazil - São Paulo.

Posted by Raissa on 2009-09-20 23:11:28

Hello Guys! I just wanted to thank you for this wonderful world tour! Thankx a lot! Vive Keane définitivement! Thank you Richard for your blogs =)

Posted by Car0le-20 on 2009-09-20 23:05:44

i really wish you guys a happy end of an AMAZING world tour. I LOVE KEANE SO SO SO MUCH! PERFECT SYMMETRY IS THE BEST ALBUM OF 2008 AND POSSIBLY OF ALL TIME. I CANT WAIT FOR THE NEXT ALBUM! VIVA LA KEANE!

Posted by angeloveskeane on 2009-09-20 23:00:33

This weekend I noticed again that the more I wanted something the more I somehow pushed it away. It seems like the Universe is playing some sick joke on me , / maybe understand others too well/ Anyway I enjoy these remarkable pics with f.e. delicious donuts- I had a taste them yet bc Kristie brought us them from US. Tim, cheers, although I don´t drink a beer but limonade or juice. Cheers, Anthony too- happy birthday.!! I must confess that the meaning of SLCś lyric is not too transparent for me, but it is lovely.I have heard just now czech singster Nohavica ,that sang Needless love-" as the light in the day, as broken swords, as losing battles,as a bitter smile, as wrecked boats as an old garb from Lithuania , you are needless, my love....."- it was protest song / with subtitle 3 variations on the same theme/ by K.Kryl in the era of socialism, but lyrics are of great import on the present too, I think. Otherwise, trees are majestic, maybe they need have other trees next to. So, I wish you to be crowned always with huge success, in love, now I must go really to bed. ...G.Night.

Posted by Denislavia on 2009-09-20 22:50:17

Hey Richard!! Thanks so much for the new pics you've added, some artwork on those buildings! Really Cool !! I'd also wish to Thank You for ALL of the pictures that you've shared while on this tour, I've enjoyed seeing each and every one of them!! Maybe after the tour you could take some pics of you guys working in the studio! I love candid shots! I can't wait til the mini cd comes out I hope that Sovereign Light Cafe' will be on it!! Thanks Again !!! I'll always look forward to your photoblogs!!!!!!!!!!!!!!!LOVE YOU KEANE!!!!!!!!!!!!!

Posted by mislynny on 2009-09-20 22:46:16

Happy Birthday Ant! ; )

Posted by Silke (Germany) on 2009-09-20 22:30:02

Beautiful pics as always Rich! Thanks! I'm just a bit sad! I will miss your tour-blogs! ******* To "Sovereign Light Café" I must say: I miss the typical and unique Keane sound! ): Maybe I must more often listen to the song. Sorry for the criticism, however it's my opinion! ******* TTR+J - Wish you guys a great last gig tonight and a safe and nice flight home! Thanks for many nice moments with you! ~~~ Much love for my favourite band... Silke ♥

Posted by Silke (Germany) on 2009-09-20 22:17:17

TODAY IS A SAD SUNDAY. THE LAST SHOW OF THE TOUR??????????????. I´M SAD. I HOPE EVERY THING GOES WONDERFUL. MISS THEM A LOT. TE QUIERO KEANE. MEXICO

Posted by shesay on 2009-09-20 22:06:17

Richard, I must say this is one of your best photoblogs ! I guess I just misunderstood something. When you said 'about to soundcheck for the last time on this tour' did you mean that's the LAST concert? The actual LAST one? (please tell me my English is getting worse, I can't believe what I understood) Anyway, I'm trying to get better from the shock... Ok, one of the greatest graffitis was the one with 'under pressure' written in the left side ! Simply awesome ! Just an observation '60 donuts consumed in the making of the Thunder Bay show' -no comments- ... I'm just wondering how a banana ketchup can be delicious... I have never tryed but it doesn't seems to work... Whatever ! Thank you one more time for sharing your pictures and I really hope this is not the last concert from the tour (ok, you deserve some rest, but please keep on playing, guys...) Love from Brazil and kisses from Rio ;**

Posted by Juliana Scaffa on 2009-09-20 21:58:03

Brillant as usual! I think Tom and Jesse were summoning the mother ship LOL! ive been sick for a cuople days, and this is the first time I've felt alittle less than shitty...

Posted by atlanic-keane on 2009-09-20 21:37:53

Hey, that's the photoblog I was waiting for ....3 days!!! Thanks Richard ! So sad cause it's certainly the last photoblog : ( Nice last gig of the tour , Keane !

Posted by Drfd on 2009-09-20 21:32:57

cool photos love them!i also love you tom

Posted by eugeniachaplin on 2009-09-20 21:28:11

Hey Richard!! I can't believe you didn't notice ALL THE MISERY YOU MADE posting that setlist (or didn't you want? Mmm...) You said nothing about SLC today!! You're so cruel... It's a great song, congrats!! BUT I have to say I waited you'd SAY ONE WORD OR TWO TO BRIGHTEN MY DAY (about SLC, obviously...) Good luck in your last show tonight and please, don't forget us during your vacations!! HUGE HUGS FROM CHILE :)

Posted by Dra_House on 2009-09-20 21:27:34

★★★★★★★★★★★ ★★★★★★★★★★ ★★★★★★★★★★ TO ENTER IN THIS WEB SITE IS AS TO RETURN HOME, A FEELING OF JOY, HEAT AND NEARNESS TO THE PEOPLE THAT WE LOVE …… THIS WEB SITE MAKES US FEEL NEAR TOM, WHO BELONGS TO OUR FAMILY ….. TOM, YOU ARE ENTERED IN OUR HEART AND YOU WILL REMAIN THERE FOREVER !!!! ;) ……… LOVE AND KISSES FROM …… ★ ….. A.B …… ★ ……. (ITALY ☼) ★★★★★★★★★★★ ★★★★★★★★★★ ★★★★★★★★★★

Posted by A.B on 2009-09-20 21:24:32

thanks for more photos Richard they make want to travel more. Great photo of Tim drinking a beer. fR

Posted by oscillate on 2009-09-20 21:04:42

MR HUGHES!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!! !!!!!! Great pics...especially those of that sick fab graffitti...cool!....KEANE:::I just want to thank you guys for such an amazing tour..you deserve a nice break...we'll gonna miss you though....Rich, I'll miss your photoblogs!!! :( ...Have a great ending of this PS Tour....and see ya next time!!!...............HugsAndKissesToKeane

Posted by samanta.g on 2009-09-20 20:56:46

Good luck with the last show, guys! It's gonna be AWESOME! Thanks for the pics, Richard -- nice to see Montréal/Canada through your eyes! Take care, and ROCK ON!

Posted by lanaban on 2009-09-20 20:41:29

Thanks,Great pics Rich! .....A big hug for you to my sweetie !!! :D see you!

Posted by RACHEL-RIO-BRAZIL on 2009-09-20 19:58:20

Thank you so much Richard for the pictures and the comments. Everything is interesting, as always. The painting with the mooses is well done I think. The pic of the reeds is nice too. Sudbery looks like a lovely city. What a wonderful welcome you had with Debbie and her crew! Amazing. You look good in the picture. The picture of Colin's back is nice too( with the tree and the sun) I wish you a great gig today! And: " Happy Birthday Ant!"

Posted by Mihajasoa on 2009-09-20 19:47:48

Banana ketchup ???????????????!!!!!!!!!!!!!!!!!!!!!!! Thanks for your PICS Richard, as always they are amazing. Enormes bisous

Posted by nis410 on 2009-09-20 19:46:44

*tears up* Im so sad!!!!! You guys are in Montreall and its so cloose to where i live and i almost bought tickets but my parents said no!!!! Arg!!! Please put up lots of pictures so i can at least see you guys!!!! Lots of Love New England

Posted by music_loves_life on 2009-09-20 19:42:09

@niza: no lo sé! Possiblemente, para sentir la pasión, el corazón, el amor? porque la vida es así! Para que nosotros nos ponemos triste y a llorar? Que malos son estos chicos!!! Bueno, soy un poquito sarcastica, oh? Algo se termina, pero al otro lado algo empieza? I guess these just are the circles of the life? Everbody´s Changing, but I still feel the same. Punto y final! saluditos y un abrazo fuerte

Posted by Johanna on 2009-09-20 19:36:17

ok, I won´t get me drunk, because there´s no sense to get drunk and afterwards sick! as a child I wanted always to drive one day such a truck, but now, no, not more ( I just would kill somebody). But thanks for taking pics of them. Somehow, I really like the babylense-Colin pic, even it looks a bit melancholic (it would more look like that, if Colin wouldn´t be there in the pic). @ Gudrun: danke! ja, ich gehe mit meiner besten Freundin und ihren beiden kleinen Söhnen hin, am Nachmittag. Ausserdem, gehts unter Woche nicht so zu.

Posted by Johanna on 2009-09-20 19:28:07

@Johanna why? why? por que tiene que llegar a un final? im enjoying this last photoblog so much! im so sad but so happy at the same time i knew they wouldn´t leave us just like that, i really love the new song...was a beautiful gift u.u

Posted by niza on 2009-09-20 19:15:06

Great ! New pictures ! Thanks Richard.

Posted by khanh on 2009-09-20 19:02:48

Great richard!! I love sovereign light cofe :D nice dayss

Posted by mich keane on 2009-09-20 18:58:17

Richard! An amazing set of pictures, as always. Loved the hares...loved the striped thing(well I would...I'm the one who was worried the dogs weren't breathing in Brazil)...but more than anything...I absolutely adore Sovereign Light Cafe(without the accent, cos I can't find one on this computer) What a beautiful song!!!!!! Love to everyone, and have a safe journey home. Lynn.xxxx

Posted by Keanelady2244 on 2009-09-20 18:56:48

@Kikaflora tikra tiesa, gaila kad mažoje Lietuvėlėje tiek nedaug žinančių Keane. Bet iš dalies aš džiaugiuosi tuo, juk esu viena iš tų keleto žmonių :) masinis vienos grupės dievinimas man ne prie širdies :)

Posted by bad_dreamLTU on 2009-09-20 18:54:47

Richard, I hope Santa brings you a tractor of your very own, one with a face like the tractor in your pic. Love the shot of Tim! Thanks. xx @Gudrun, I rekon it's a phone but I can't stare at it for too long in case hubby catches me! x

Posted by sam (uk) on 2009-09-20 18:36:39

Lovely pictures as always, Thank you so mcuh Richard.....and Tom still wear his blue T-shirt..(lol)...Love from Taiwan-Chi

Posted by rainborn8228 on 2009-09-20 18:23:07

What is it that Jesse´s got in his left pocket? A pack of cigarettes? LOL - @johanna: Du gehst wirklich auf die Wies´n? Na dann - viel Vergnügen!

Posted by Gudrun (Austria) on 2009-09-20 18:20:34

i think if i went into a bar and came across keane sitting outside, that might just become my favourite bar in the whole world! Particularly like the ones of Jesse hanging off a lamp post and Tim drinking his pint! xxx

Posted by emmakate3 on 2009-09-20 18:13:03

@niza: parecé que se dispertó, vaya que mala escusa: software-problems, lol! Oh, Happy Birthday to Ant!

Posted by Johanna on 2009-09-20 18:10:57

aaaaaaaaahhhhhhhh, oooooooohhhhhhhh, uuuuuuuhhhhhhhhhhh next wednesday I´ll go to the Wies´n and get me drunk, like all the bavarians do! Thank youssssssssssssss

Posted by Johanna on 2009-09-20 18:09:56

--------> HAPPY B-DAY ANT ---------> HAVE FUN !!!!! --------> HAPPY B-DAY ANT ---------> HAVE FUN !!!!! --------> HAPPY B-DAY ANT ---------> HAVE FUN !!!!! --------> HAPPY B-DAY ANT ---------> HAVE FUN !!!!! --------> HAPPY B-DAY ANT ---------> HAVE FUN !!!!! --------> HAPPY B-DAY ANT ---------> HAVE FUN !!!!! --------> HAPPY B-DAY ANT ---------> HAVE FUN !!!!! --------> HAPPY B-DAY ANT ---------> HAVE FUN !!!!! --------> HAPPY B-DAY ANT ---------> HAVE FUN !!!!! --------> HAPPY B-DAY ANT ---------> HAVE FUN !!!!! --------> HAPPY B-DAY ANT ---------> HAVE FUN !!!!! --------> HAPPY B-DAY ANT ---------> HAVE FUN !!!!!

Posted by niza on 2009-09-20 17:58:11

@Johanna, Cool ! i a follow keaneshadow too!! add me on twitter if you want @nizaiglesias!, ;)

Posted by niza on 2009-09-20 17:52:32

There are many beautiful photos, but please change the blog or the photos!!!!!!!!!!!!!!! ;)

Posted by naye on 2009-09-20 17:10:20

I LOVE THE NEW SONG! :D AMAZING :D

Posted by ElinWallstrom on 2009-09-20 16:05:35

Amazing photos Richard (and Ant)! Can you believe how much buzz the photo of the set list generated? All of us are anxiously anticipating hearing SLC again and for its official release. BTW, you can now enjoy the finest cup of coffee in North America when you're in NYC. Stumptown just opened a branch here. http://www.nytimes.com/2009/09/16/dining/reviews/16brief-001.html?_r=2 &scp=3&sq=stumptown%20coffee&st=cse

Posted by karleu on 2009-09-20 15:29:52

@niza: thanks, but as I follow Keaneshadow on twitter, I got the download, there and I saw that someone has already put it on the forum aswell. But, that´s very kind from you, hugs to you! At least I found another version of Fatboy Slim, with the cats. Yes, the little cats are very cute & funny, but with my silly mind, I also think, hmm, don´t know, if it isn´t a bit strange to do something like this with cats? Oh, sorry, I´m still feeling quite rubbish and I maybe shouldn´t make an own mind-review of my Keane-experience of this year. But, the thoughts always came to my mind and I don´t know, how to deal with it. Where´s my bright sight? I should be very lucky, that I could see Keane this year 7 times, that´s quite crazy! And I´m lucky, when I see my own Keane-videos.

Posted by Johanna on 2009-09-20 15:19:17

Wow! Very magnificent pictures. Kisses from Germany!

Posted by Chriissy on 2009-09-20 15:08:43

Oooh, one falls in love with SLC within the first 5 chords.... then it only keeps getting better..... very Beatlesey.

Posted by picklepine on 2009-09-20 14:59:04

@Agnes(Fr-15/07/2007) Yes i havent slept i was waiting all night for the a SLC recording, and it worth it, if you want a copy send me an e-mail nizaiglesias@hotmail.com ---> same for @Johanna

Posted by niza on 2009-09-20 14:40:58

@Niza : Big thanks for the video... I think I had already seen it on MTV, but I had completely forgotten it !... Too cute the cat with the hat of a Joker... By the way, great song !... Also reminds me that we have to cope with a joker who's playing a kind of super-vilain with our nerves here, these last days !!!...

Posted by Agnes(Fr-15/07/2007) on 2009-09-20 13:53:05

The more I listen to SLC the more I LOVE it!!! ♥ it's such an amazing song, specially the version that you made in Kitchener, 'cause Tom sings one of his typicals acute screams 'YEEEEEH' in some parts of the song(after the la la la la ♪) and it's AMAZING, Tom's voice is the sweetest voice EVER ♥.♥ I LOVE SLC! By the way... what about updating something today?? ANYTHING! I NEED UPDATES!! It's been THREE days since the last update x_______x

Posted by lalivaldez on 2009-09-20 13:40:16

yees! HAPPY BIRTHDAY ANT!!!! HAVE A NICE DAY! :) happy 29! ♥

Posted by lalivaldez on 2009-09-20 13:28:59

Les photos sont magnifiques & j'aime beaucoup celle du gros calin entre Tom & l'ours :P. LOVE KEANE

Posted by Chaaarlotte on 2009-09-20 13:25:03

HELOISA, ISA FROM BRASIL, SAO PAULO ********* THANK YO FOR YOUR EXPLANATION, wrightk15 , I saw part of the lyric at the forum, but it seems it´s not the full version and it´s a bid confused... anyway, I am still trying to have the lyric to sing along with Keane this new song! :.) HELLO THERE KEANE STAFF, POST HERE THE SONG/LYRIC SOVEREIGN LIGHT CAFE, PLEASE! :.) LOTS OF LOVE TO MY FAVOURITE BAND! IS IT YOUR BIRHTDAY ANT? HAPPY BIRTHDAY AND HAVE A NICE DAY! LOTS OF LOVE! XXXXXXX

Posted by isa on 2009-09-20 13:08:07

--------> HAPPY B-DAY ANT ---------> HAVE FUN !!!!!

Posted by niza on 2009-09-20 12:49:42

@Johanna i really hope you feel better today...the link was to share with you a really cool vid well I like it a lot ...it was "The joker by Fat boy slim", anyway, i think we have to take advantage of the freedom that we have today cuz we don´t know if we´ll have that "privilege" tomorrow, history has managed to show us how to appreciate liberty, but sometimes it´s so easy to make the same mistakes..:/ well that´s not going to cheer u up anyway, sorry! i bet a good update can do that! slds desde magallanes, chile!

Posted by niza on 2009-09-20 12:11:27

I heard your new song "Sovereign light café" and I like it. So great!!!! I hope that it will be very soon in a new album (after holidays and a well-deserved rest, of course) Today is the last day of your Perfect symmetry's tour. I'm thinking of you !!!!!!! Enormes bisous

Posted by nis410 on 2009-09-20 11:46:16

@niza: thanks, for your try to want to cheer me up! Sadly, the video is in my country owner protected so I can´t watch it. Sometimes, I think, it´s just a question of time, when our politics invent a tax for humans for every breath they take. To complete their unspoken plan, how rich people get richer and poor people get poorer. Ok, they might be also some good things in this country where I´m living (called Germany) but sometimes it makes me sick! And it´s not because of the fact, that videos/music is protected. Sorry, for my bad mood I´m feeling, I hope & wish you feel better. Hey, maybe today we have luck, to have a better day? Wishful thinking & daydreaming is good to break out of the cages, hehhhehhheeee. Saludos!

Posted by Johanna on 2009-09-20 11:11:11

@bad_dreamLTU kažką panašaus ir aš galvojau...Kiek kieno nors paklausi ,,Ar žinai kas yra grupė Keane?'' tai niekas apie tokią nėra girdėjęs... Bet labai gaila, nes jų muzika tikrai gera... Fan from Lithuania

Posted by Kikaflora on 2009-09-20 09:51:15

Thank you thank you thank you for the Kitchener show, it was so fantastic. You guys are so great live, so very much better than on the albums. Richard you're so friendly and personable in person, thank you for taking the time to come out and chat in the cold. Thanks to Tim too, you looked shy, but you did it anyway, I appreciated that so much. Much love to you all and have fun in Montreal. Safe travels home.

Posted by hereforthemusic on 2009-09-20 08:14:17

we are so spoiled with demanding updates to the blog. lol. given that, i would love to see some thunder bay and old montreal pics. i know you cats are pretty busy and winding down. you deserve the upcoming time off but just having one day left for the ps tour makes me catch my breath in melancholy. :(

Posted by lord_byron on 2009-09-20 07:27:45

My dearest Tom.. I'm always with you,for ever and ever!! I love you so much, THANKS TO EXIST !! A big kiss* take care. With love,- Rachel

Posted by RACHEL-RIO-BRAZIL on 2009-09-20 03:26:27

Good luck in Montreal Keane ! Wishing you a nice Sunday, safe and happy return way home.Full of Joys.Thank you for everything. Warm Hugs..from BRAZIL

Posted by RACHEL-RIO-BRAZIL on 2009-09-20 03:11:27

@Johanna, yeap looks like no update today :/ ...thanks for the link i like that song...i try with this vid when im not feeling well ---> http://www.youtube.com/watch?v=Xgk9ouBuj-4 ....it always cheers me up, hablamos mañana slds niza xx

Posted by niza on 2009-09-20 01:54:21

@niza: well, it looks like they´re still busy. Finally, I could take a bit of time to watch a movie called "Once". Nice music, but hhmm my dizzy mood didn´t get better with it. So, a good song, which always do work on me is this one: http://www.youtube.com/watch?v=AhxikEfBgKU. It´s not Keane, but I really like it. And I hope Keane doesn´t mind, that I posted this link here! Buenas noches y un abrazito fuerte, besitos!

Posted by Johanna on 2009-09-20 00:46:55

Please!!!!!!!!!!!!!!!! change the blog!!!!!!!!!!!!!!!! ;)

Posted by naye on 2009-09-20 00:41:38

I went to the show in Winnipeg this week and I was blown away by how incredible you guys were live!! I am also from England and I've lived here for a few years now and your stellar performance and how lovely you were to the audience just made me very proud to be English :) Thank you SO much for coming here!!

Posted by fuchsiag on 2009-09-20 00:05:19

This very fresh song with nice title and with very positiv energy reminds me some period of hapiness and improvidence in my life., when I had heard another music with another singer... And now it helps me to forget about all sadness and desolation. Heraclitos said: " You could not step twice into the same rivers for other waters are ever flowing on to you." I think these current waters are even nicer and more beautiful........ wish all the best, good luck, with love

Posted by Denislavia on 2009-09-20 00:04:02

@ lalivaldez i feel the same way!!! i have no life, keane is all !! XD

Posted by niza on 2009-09-19 22:47:51

@Johanna: Hola ! Hello! Hallo!... this is mean indeed! i hope they give us something before tonight´s gig...and btw...we should really have a blog here, or like some kind of chat window...whatever so we can communicate better! :) ---> come on lazy rich show up!

Posted by niza on 2009-09-19 22:43:56

I must admit, I'm kind of desesperated now, WHAT'S HAPPENING WITH THE GUYS? it's been two days since the last update *__* and if they're absent now that they're still on tour, what can we expect of next week? that the tour will be officially over, :( it makes me think that they're gonna vanish on air :( ohh what am i gonna do without all this updates????????

Posted by lalivaldez on 2009-09-19 22:24:31

Good luck with the last show of the tour tomorrow! It must have been a pretty epic year for both band and crew!? HINT HINT...another london show would be the mahoosive juicy cherry to top off a perfect year! xxxx

Posted by emmakate3 on 2009-09-19 22:17:33

@niza: hola? hallo? hello? I´m also wondering, what happens! 2 days without an update? Is this a kind treatment, do they have problems, is Richard just lazy? Why do I write stupid things? Should we do here our own blog? or what? well, I need to do my ooohhhhhs, uuuuuuhhhhhhhs & aaaaahhhhhhssssss and thank yousssssssssss

Posted by Johanna on 2009-09-19 21:50:31

@isa, sorry but the audio on the videos we have seen so far is not so good and even we English speakers can't work out the lyrics yet. We'll have to wait for more videos with better sound, or something direct from the band. Lovely catchy tune though.

Posted by wrightk15 on 2009-09-19 21:50:05

HELOISA, ISA FROM BRASIL, SAO PAULO ******* PLEASE, SOMEONE who speaks and understand English well, can you post here Sovereign Light Cafe lyric, please? I could not understand well the lyric, so, pleaaaaaaaaaaaaaaase? Thank you in advance, a good soul and a fan Keane, pleaaaase! LOTS OF LOVE TO MY FAVOURITE BAND! XXXXXX

Posted by isa on 2009-09-19 21:16:09

Kikaflora>> huray!!!! Fan from Lithuania!!! net neįsivaisdavau, kad Lietuvoje yra Keane fanų :D malonu žinot, kad ne aš viena tokia ;)

Posted by bad_dreamLTU on 2009-09-19 21:16:06

--------> haaaaa im going to die, it´s so quiet in here !!!

Posted by niza on 2009-09-19 21:08:10

p.s- i love the new backgound of this website! I go past this building everyday =P

Posted by gtse on 2009-09-19 20:14:02

awesome photots! i am glad ur enjoying ur road trip. And if u wanted to know the sculpture that was taken at the university of calgary (the first photos), engineers hung a car from it a couples years back ;) Enjoy the rest of ur time here in Canada eh!!!!! =)

Posted by gtse on 2009-09-19 20:09:34

cool picks!lol so cute i wish i was that bear............so tom hugged me....I LOVE YOU TOM I LOVE YOU SO MUCH!!!

Posted by eugeniachaplin on 2009-09-19 18:05:40

If you guys are looking to do some sightseeing in Kitchener, you have to check out the St. Jacobs farmers market at the north end of the city. Local Mennonites sell their produce and goods here, and it is what the area is best known for. Thank you for coming to the Waterloo Region! Greatly looking forward to the concert tonight. Craig

Posted by gumby1 on 2009-09-19 17:41:52

nice photo Rich, thanks, especially those fisheye ones and starry sky! & I wanna be that bear, Tom..:)

Posted by jellyfish on 2009-09-19 17:08:08

I love keane. Boys, you're the best =D The best band. I LOVE YOU TIM!!! ami_keaner =D from argentina

Posted by ami_keaner on 2009-09-19 16:58:17

the NEW song is AMAZING!!- I love KEANE!!.

Posted by alechaplin on 2009-09-19 16:57:50

Wow new song! Congratulations guys! Hope it's good song =) P.S. I hate flu cos I have got a terible one now ! I wonder who has got a flu today too... A@ from Lithuania =]

Posted by Kikaflora on 2009-09-19 16:52:15

Great and fabulous pictures there Richard. Those flying little thing is Grasshopper and i liked very much the picture with the starry night. love from switzerland.....drmx74

Posted by drmx74 on 2009-09-19 16:36:47

Keane keane keane keane keane keane!!!!!!!!!!!!!!!!!!

Posted by guille =) on 2009-09-19 16:14:16

AMO SOVEREIGN LIGHT CAFE!!! KISSES FROM ARGENTINA

Posted by YESICA on 2009-09-19 16:10:39

Honestly Rich you take wonderful pictures!!!!!!!!!!!! every single one of them, a pleasure to take a look at them and imagine the wonderful places you must be visiting.. continue rocking Keane!! WE LOVE YOU GUYS, GOOD LUCK! ;) Hugs from Argentina, always.

Posted by .: Jime :. on 2009-09-19 15:42:08

Love it hope we can get hold of it soon xxx

Posted by ruthie on 2009-09-19 15:03:34

Here ist ist ! http://www.youtube.com/watch?v=qaruafW2cJE Enjoy !

Posted by timmilie on 2009-09-19 12:19:02

okay, i think i have recovered. good to finally know about the new song. i was on my iphone at the gym working out last evening STILL trying to find out the 411. i was dying!!!! thanks for teasing us rich and km.com!

Posted by lord_byron on 2009-09-19 11:28:17

Soveirgn Light Cafe??? happy to see a new song to the setlist ^^ hope you will give more informations about it soon !!!! kissssssssssssssssssssssssss love you guysssssss!!!!!!!!!!!!!!

Posted by fanofmusic4 on 2009-09-19 10:28:10

hi guys!!! really beautiful pics as always ^^ thanks for sharing them !!!! I love the pic where tom make a hug to the bear , it's soooooooooooo cute :-) i wish he could do one like this to me :-) !!!! big kissssssssssss tooooooooo you guys!!!!!!!

Posted by fanofmusic4 on 2009-09-19 10:25:18

Soveirgn Light Cafe! Wow! a new song?! OMG!!! Those people in Thunder Bay are lucky! And Congrats!!! =D I hope the band and the crew have a nice rest after this world tour!!! Thank you Richard for your great photos!!! Syrinx from Guangzhou, China

Posted by Syrinx on 2009-09-19 09:31:58

I'm pretty sure that bug is a grasshopper... or at least that's what I always thought they were. Love the pictures rich! The water at that lake looks so clean and clear... great job capturing that. ;) I love you guys! ---- Mandy- USA, Ohio. (Next time you tour here, consider playing in Columbus OH, they have some pretty cool venues... just a thought.)

Posted by oddone460 on 2009-09-19 06:59:53

*************Pleaze!!!!!!!!!!!!! new photos!!!!!!!!!!!!!! :) KEANE Always the best band**************

Posted by naye on 2009-09-19 01:58:40

Come on... KEANE i want to know more about that new song.. and let´s face it the sound of those vids sucks... (thanks for share them anyway) x.x

Posted by niza on 2009-09-19 00:59:48

Thanks for the update, Richard! I love your photos so much. Much love to Keane and the crew.

Posted by sharksushi on 2009-09-19 00:34:20

Richard: amazing photos as usual!! Please play Soveirgn Light Cafe tomorrow in kitchener!! see you tomorrow night in kitchener!!!! Love you KEANE!!

Posted by Fly-To-Me-Keane on 2009-09-19 00:05:05

Honestly, until now there's no ♥KEANE♥ song that I don't like and so, I live a bit in dread of not to be really taken with one of them !... This stuff reminds so much good souvenirs when we were anxiously waiting the release of PS... People are so perceptive, then thanks for this recording or ♥how to help you to fall in love again in few seconds♥... Well, bright and I think I'll love it ! But however, I wait to listen with a best quality of sound !!!... G'Night.

Posted by Agnes(Fr-15/07/2007) on 2009-09-18 23:35:45

@niza: oh, thanks, you´re also welcome! I think I´m in love with this song! I´m done, lol!

Posted by Johanna on 2009-09-18 23:34:52

woow I think Rich is excited to take pictures of animals jajaja, in one of those photos there is a Transformers jajaja. UP KEANE!

Posted by keane_8@hotmail.com on 2009-09-18 23:22:50

@Johanna you´re welcome, look here for another vid version of that new lovely song "Sovereign Light Cafe" ---> http://www.youtube.com/watch?v=ivC9cA_r5kw

Posted by niza on 2009-09-18 23:01:08

If you want to see some more super awesome pictures of Winnipeg, check out this blog: http://www.winnipeglovehate.com/ It's one of my favourite local photo blogs.

Posted by dougmcarthur on 2009-09-18 21:19:24

So, if it´s really important to give an opinion about the new song? Because, maybe I´m having a bad taste of music? as a customer today told me that the recent music, I was playing at the store, wouldn´t be a good one for shopping ( and I played the new Muse-cd, which I think it´s not bad, maybe next time I should pick up Metallica or Marilyn Manson for getting people in a better shopping mood?) well, at the first time it didn´t get me so much, as the youtube-version-sound quality isn´t the best, but maybe, well I have to add me, that more I listen the more I like it. It´s a growing song. Even, today I was more in the mood of the old rare Keane-song: Something In Me Was Dying and thought this would be a perfect song, while you drive a cabrio-car, through a lonely beautiful road, something like that.

Posted by Johanna on 2009-09-18 21:16:45

I mean... *Cheers lol

Posted by yessicachaplin23 on 2009-09-18 21:12:27

@niza: good-evening, sorry I was for some hours working, but now I´m back and want to thank you for the good-morning answer, hehheee!

Posted by Johanna on 2009-09-18 21:08:51

hey guys! ... I totally loved the new song!! ...it's really awesome :D ...thank you! Chees from Mexico city ;)

Posted by yessicachaplin23 on 2009-09-18 21:07:33

The mirror picture is pretty awesome. And nice set list! It has my favorite song on it, which I'd love to see live, but it hasn't happened quite yet.

Posted by Guitargirl496 on 2009-09-18 20:50:36

SOVEREIGN LIGHT CAFÉ''.......................THIS SONG IS A TREASURE. SALUDOS MEXICO

Posted by shesay on 2009-09-18 20:49:37

I love your photos Richard, you have such an eye for what looks good and even manage to make, what would normally be, boring pictures look interesting. I reckon you could earn your living out of photography, but having said that, don't dare leave Keane to take it up!!! When I was in Calgary, I also took the same photo of the sculpture in the campus, it was great to see the scenery again, such a beautiful country and the canadians are such friendly people. Keep posting those photos Richard, they really cheer me up. Love you guys so much XXXXXXX

Posted by jo-anna on 2009-09-18 20:39:11

Richard, the pictures are so beautiful ! I keep wondering how do you have courage to photograph in all those cities with a camera like yours ! I mean, it's a great camera and it must be dangerous to walk around these foreing countries without actually knowing how safe the place is... Anyway, thaks for sharing your day with us ! We all love you (and Keane!!!) LOL kisses from Rio-Brazil ;**

Posted by Juliana Scaffa on 2009-09-18 20:21:36

★★★★★★★★★★★ ★★★★★★★★★★ ★★★★★★★★★★ TOM, A HIDDEN LOVE IS LIKE THE SUN BEHIND THE CLOUDS, AS A FLOWER UNDER THE SNOW, AS A TEAR IN THE SEA …… BUT IT’S STRONGER THAN THE OTHERS BECAUSE IS HIDDEN INSIDE THE HEART, WHERE NOBODY WILL NEVER STEAL IT !!!!! ♥♥♥ TOM ♥♥♥, YOU ARE UNIQUE !!!!!!!!!!!!!!!!!!!! ……… ♥♥♥ WE LOVE YOU A LOT ♥♥♥ ……… LOVE AND KISSES FROM A.B (ITALY) ……. ★★★★★★★★★★★ ★★★★★★★★★★ ★★★★★★★★★★

Posted by A.B on 2009-09-18 20:12:50

Is SLC a commercial jingle or a song for the mini album??? Whatever it is, it'll def. attract customers! Cheers!

Posted by NYC>Sydney on 2009-09-18 19:56:58

Thanks Tim, Tom, Rich and Jesse for the new song!!!!!! It's brilliant, wonderful, etc!!!!!. Keane, you four are the best!!!!

Posted by Daniel (Peru) on 2009-09-18 19:44:13

Wow, I found these really cool pictures, especially the picture with Tom Chaplin hugging that huge bear! I love this band and a cousin of mine too!

Posted by rickeane on 2009-09-18 19:27:30

BTW, Does anybody have the lyrics??

Posted by Dra_House on 2009-09-18 19:22:27

Sorry, Richard, but this photoblog turned into "Sovereign Light Café Blog" :D Hi-hi-hi.... The more I listen to this song, the more I love it!! HUGE HUGS FROM CHILE :)

Posted by Dra_House on 2009-09-18 19:21:07

Yessssssss ! I got it right : it’s a pop-folk ballade ! Sorry, it’s a “fresh and relaxing” pop-folk ballade! But lyrics may show the opposite.... Does anyone know what it’s all about? Kenza-ALGIERS-ALGERIA

Posted by TimTamTom on 2009-09-18 18:49:41

"something in me was dying" 'cause for the first time I don't understand one Keane song's lyrics ^^ But it's a greaaaaaaaaat song anyway ! Kisses from Charlotte in Paris

Posted by littlemisscharlotte on 2009-09-18 18:38:57

It is about this happy little chinese girl Chi? Lyrics must be very exciting :)and music divine - as usually! have a very nice weekend, boys!

Posted by Denislavia on 2009-09-18 18:21:47

thanks thanks thanks BIG thanks to the kind persons who posted the link!! I've just heard the song and IT'S GREAAAT!!!! I REALLY LOVE IT♥♥♥♥♥♥♥ la la la la la la♪ I'll be singing -well, humming- the song all day long! it's already in my mind!!! I hope you guys upload it here!! please! or at least the lyricss!! aaw, I'm so exciting about it! kfjsfkjds THANKS♥

Posted by lalivaldez on 2009-09-18 18:12:59

I think I finally found the place that inspired for the "Sovereign Light Cafe" title, check it out : http://www.keane.fr/galerie.php?cat=pros&lien=alexlake/tsd0708&img=01 ha ha ha lol lol Kenza-ALGIERS-ALGERIA

Posted by TimTamTom on 2009-09-18 18:10:39

Hey guys!!! Thank you so much for everything!!! You´re the best♥ Love from Germany

Posted by Julia B. on 2009-09-18 17:54:51

i love it!!!!thanx for posting!!!!

Posted by vicichuela on 2009-09-18 17:39:16

What a teaser.. well thanks to the wonders of youtube I have now heard it. loving it but how about posting the lyrics next? :D

Posted by Stephanie on 2009-09-18 17:33:12

OMG !! EVERY DAY THEY COME OUT SOMETHING NEW THIS BOYS !!! WE LOVE THEM !!! THANKS TO EVERYONE FOR THE LINK !

Posted by THEYROCKMYWORLD on 2009-09-18 17:31:03

I ALLREADY LOVE THE SONG !!! BUT I NEED THE LYRICS.. lol

Posted by THEYROCKMYWORLD on 2009-09-18 17:27:21

lbomb8 you're amazing! thank you so much :D it sounds great =) i like it.

Posted by UnInspired on 2009-09-18 17:25:51

http://www.youtube.com/watch?v=qaruafW2cJE SLC

Posted by charlotteh on 2009-09-18 17:12:56

@lbomb8: Thanks so much!! :D It's a great song!! I loved it :)

Posted by Dra_House on 2009-09-18 16:56:40

WHOOPS looks like i'm not the first one lol. I'm so excited by this!

Posted by emmakate3 on 2009-09-18 16:56:14

Here is a link to Sovereign Light Cafe on youtube which some lucky person managed to film last night! http://www.youtube.com/watch?v=qaruafW2cJE ENJOY! XXX

Posted by emmakate3 on 2009-09-18 16:54:25

Lucky people who were last night in the gig SOVEREIGN LIGHT CAFÉ is just GREAT!!!!!!!! Love from Colombia... Come back soon =)

Posted by lizetho on 2009-09-18 16:45:35

Loving our Friday treat of Sovereign Light Cafe - what a way to start the weekend - a new Keane song! Yes! X

Posted by JaneA on 2009-09-18 16:38:06

http://www.youtube.com/watch?v=qaruafW2cJE Keane- Sovereign Light Cafe. Thank so much Keane amazing performance as usual..TOM your voice drive me crazy.Love you! bunch of hugs & kisses from RIO/BRAZIL

Posted by RACHEL-RIO-BRAZIL on 2009-09-18 16:36:35

For those of you that can't get into the forum or don't have Twitter, here is the youtube link to "Sovereign Light Cafe": http://www.youtube.com/watch?v=qaruafW2cJE Can't really hear the words all that well, but it's something!! :) Kudos goes to lbomb8 for uploading it.

Posted by Emmybear on 2009-09-18 16:29:44

@ Gudrun and all the others, just saw the video on youtube. Leider haut er einem nicht aus den Socken. Keane goes folk?

Posted by vivienne04 on 2009-09-18 16:26:33

http://www.youtube.com/watch?v=qaruafW2cJE ! I FOUND SOMETHING PEOPLE !

Posted by THEYROCKMYWORLD on 2009-09-18 16:24:41

Please, canadian fans, we want to listen to Sovereign Light Cafe! Anyone has the song's video?

Posted by Juliana (Brasil) on 2009-09-18 16:08:24

Somebody is teasing us with a carrot dangling in front of us donkeys ... ;-)

Posted by Gudrun (Austria) on 2009-09-18 14:19:43